|
Left Crispr |
Right Crispr |
| Crispr ID |
944519853 |
944519856 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:200554462-200554484
|
2:200554499-200554521
|
| Sequence |
CCTATAGCTGATTATAAATTACC |
AAAACAAGACAATTGTCTGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 25, 3: 84, 4: 192} |
{0: 2, 1: 4, 2: 1, 3: 37, 4: 337} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|