|
Left Crispr |
Right Crispr |
| Crispr ID |
944520984 |
944520990 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:200566717-200566739
|
2:200566751-200566773
|
| Sequence |
CCGGCTTCAAGCTTCCTAGCCGC |
ACTCAAGCCTCAGCAATGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 86, 4: 734} |
{0: 373, 1: 643, 2: 583, 3: 805, 4: 2150} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|