ID: 944534474_944534477

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 944534474 944534477
Species Human (GRCh38) Human (GRCh38)
Location 2:200695761-200695783 2:200695779-200695801
Sequence CCCATCTGCAGCTGTGCCTTTGC TTTGCCACCTTCTGCCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 235} {0: 1, 1: 0, 2: 2, 3: 31, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!