ID: 944586620_944586640

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 944586620 944586640
Species Human (GRCh38) Human (GRCh38)
Location 2:201178816-201178838 2:201178869-201178891
Sequence CCTTCTCCAATCTTGAAGTGGGG AATGGGAGGCAGAAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!