ID: 944605542_944605554

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 944605542 944605554
Species Human (GRCh38) Human (GRCh38)
Location 2:201348625-201348647 2:201348653-201348675
Sequence CCCCCCACCACCCCCTTACACAC GGCACACACACACTCAGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 152, 4: 1416} {0: 1, 1: 0, 2: 3, 3: 31, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!