ID: 944620871_944620879

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 944620871 944620879
Species Human (GRCh38) Human (GRCh38)
Location 2:201514947-201514969 2:201514999-201515021
Sequence CCAATTTTTTTTGCAAAACCAAA CTAAACACACTATTACCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 698} {0: 1, 1: 0, 2: 2, 3: 23, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!