ID: 944625469_944625472

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 944625469 944625472
Species Human (GRCh38) Human (GRCh38)
Location 2:201564203-201564225 2:201564233-201564255
Sequence CCCAGCTTCAAATCATTTCAATT TAATTGAATTAAAGTGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 57, 4: 381} {0: 1, 1: 0, 2: 2, 3: 23, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!