ID: 944637603_944637607

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 944637603 944637607
Species Human (GRCh38) Human (GRCh38)
Location 2:201689900-201689922 2:201689924-201689946
Sequence CCGAGAATTATTACTATAACATT CCCTGTTTATGAAGGGCAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 431} {0: 1, 1: 0, 2: 2, 3: 9, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!