ID: 944640050_944640059

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 944640050 944640059
Species Human (GRCh38) Human (GRCh38)
Location 2:201715722-201715744 2:201715748-201715770
Sequence CCATGCTTTCCAAACTTCCCCTT CTGGGCCCTCACAGCCCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 374} {0: 1, 1: 1, 2: 0, 3: 22, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!