|
Left Crispr |
Right Crispr |
| Crispr ID |
944654551 |
944654565 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:201864667-201864689
|
2:201864718-201864740
|
| Sequence |
CCGGGATTACAGGCATGAGCCAC |
CAAAGGAAACAGAAGGGGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1406, 1: 3588, 2: 4650, 3: 4179, 4: 4000} |
{0: 1, 1: 0, 2: 6, 3: 81, 4: 921} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|