ID: 944675833_944675845

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 944675833 944675845
Species Human (GRCh38) Human (GRCh38)
Location 2:202033817-202033839 2:202033870-202033892
Sequence CCCGACGCTTCTTCTGGCGACCA CTCCCGGCGGGCGGCGGCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 18, 3: 124, 4: 764}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!