ID: 944675836_944675848

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 944675836 944675848
Species Human (GRCh38) Human (GRCh38)
Location 2:202033837-202033859 2:202033873-202033895
Sequence CCAGCGCGACTCCGAGGCGTTAG CCGGCGGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary No data {0: 4, 1: 29, 2: 178, 3: 806, 4: 2679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!