ID: 944675838_944675842

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 944675838 944675842
Species Human (GRCh38) Human (GRCh38)
Location 2:202033848-202033870 2:202033861-202033883
Sequence CCGAGGCGTTAGTCGGCGCTCAC CGGCGCTCACTCCCGGCGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 1, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!