ID: 944675838_944675850

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 944675838 944675850
Species Human (GRCh38) Human (GRCh38)
Location 2:202033848-202033870 2:202033879-202033901
Sequence CCGAGGCGTTAGTCGGCGCTCAC GGCGGCGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary No data {0: 1025, 1: 1397, 2: 2293, 3: 4170, 4: 7329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!