ID: 944675838_944675853

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 944675838 944675853
Species Human (GRCh38) Human (GRCh38)
Location 2:202033848-202033870 2:202033890-202033912
Sequence CCGAGGCGTTAGTCGGCGCTCAC CGGCGGCGGCGGCGGGCGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 20, 2: 132, 3: 632, 4: 1907}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!