ID: 944684263_944684272

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 944684263 944684272
Species Human (GRCh38) Human (GRCh38)
Location 2:202104460-202104482 2:202104510-202104532
Sequence CCAGCCTCCAGGAGGCAGAAGGC TGGTTTTCACAGAAGGAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 381} {0: 1, 1: 0, 2: 0, 3: 29, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!