ID: 944726684_944726692

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 944726684 944726692
Species Human (GRCh38) Human (GRCh38)
Location 2:202478486-202478508 2:202478508-202478530
Sequence CCCGTACTTCCAAAGTAGTCCCA AACTGTTTGGAAGGCTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} {0: 2, 1: 33, 2: 841, 3: 13599, 4: 107957}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!