ID: 944743621_944743642

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 944743621 944743642
Species Human (GRCh38) Human (GRCh38)
Location 2:202635192-202635214 2:202635242-202635264
Sequence CCCAGCGGGTGAGGCGCAATGGG GGTGGTGCGGTGGCCACGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69} {0: 1, 1: 0, 2: 1, 3: 28, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!