ID: 944744801_944744803

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 944744801 944744803
Species Human (GRCh38) Human (GRCh38)
Location 2:202644650-202644672 2:202644669-202644691
Sequence CCAGACCTTGAATATCTTCAGTG AGTGATGTCTTTATACTTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 144} {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!