ID: 944760547_944760553

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 944760547 944760553
Species Human (GRCh38) Human (GRCh38)
Location 2:202809383-202809405 2:202809399-202809421
Sequence CCCACGCCTGTAATCCCAGTACT CAGTACTTCGAGAGGCCAAGCGG
Strand - +
Off-target summary {0: 28, 1: 1207, 2: 3363, 3: 3196, 4: 2441} {0: 1, 1: 4, 2: 146, 3: 1736, 4: 3632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!