|
Left Crispr |
Right Crispr |
Crispr ID |
944760547 |
944760553 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:202809383-202809405
|
2:202809399-202809421
|
Sequence |
CCCACGCCTGTAATCCCAGTACT |
CAGTACTTCGAGAGGCCAAGCGG |
Strand |
- |
+ |
Off-target summary |
{0: 28, 1: 1207, 2: 3363, 3: 3196, 4: 2441} |
{0: 1, 1: 4, 2: 146, 3: 1736, 4: 3632} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|