|
Left Crispr |
Right Crispr |
| Crispr ID |
944763439 |
944763445 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:202840696-202840718
|
2:202840715-202840737
|
| Sequence |
CCCGCTGCAGGGCAGCCTCCAGC |
CAGCTCGGAGAGCTTGGCATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 16, 2: 23, 3: 87, 4: 556} |
{0: 1, 1: 1, 2: 13, 3: 24, 4: 140} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|