ID: 944821853_944821857

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 944821853 944821857
Species Human (GRCh38) Human (GRCh38)
Location 2:203440288-203440310 2:203440302-203440324
Sequence CCCCAGGGCTGGACGTCTTACTG GTCTTACTGGTCTTTTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88} {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!