ID: 944821853_944821860

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 944821853 944821860
Species Human (GRCh38) Human (GRCh38)
Location 2:203440288-203440310 2:203440321-203440343
Sequence CCCCAGGGCTGGACGTCTTACTG CTGGAGATCCACTTTTGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88} {0: 1, 1: 0, 2: 1, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!