ID: 944833632_944833637

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 944833632 944833637
Species Human (GRCh38) Human (GRCh38)
Location 2:203557243-203557265 2:203557258-203557280
Sequence CCATTATCTGTATTTGGGAATCC GGGAATCCTGGGGAAAAAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!