ID: 944905224_944905229

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 944905224 944905229
Species Human (GRCh38) Human (GRCh38)
Location 2:204255574-204255596 2:204255623-204255645
Sequence CCCTGACTTCTCTTTCCTCCTGT TCCCAGTGAATAAGGTCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 92, 4: 778} {0: 1, 1: 0, 2: 1, 3: 21, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!