ID: 944908886_944908890

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 944908886 944908890
Species Human (GRCh38) Human (GRCh38)
Location 2:204289935-204289957 2:204289981-204290003
Sequence CCAAACAAGAATGTTTTGTCCAG ACTTATTTCAAGAGCATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!