ID: 944938018_944938027

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 944938018 944938027
Species Human (GRCh38) Human (GRCh38)
Location 2:204589981-204590003 2:204590005-204590027
Sequence CCTTCCTCCCTTGATATTTCCCA ATATGAAATGGGAAGGATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 351} {0: 1, 1: 0, 2: 4, 3: 41, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!