ID: 944938018_944938029

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 944938018 944938029
Species Human (GRCh38) Human (GRCh38)
Location 2:204589981-204590003 2:204590020-204590042
Sequence CCTTCCTCCCTTGATATTTCCCA GATAATGGGTTTCTGCTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 351} {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!