ID: 945000223_945000229

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 945000223 945000229
Species Human (GRCh38) Human (GRCh38)
Location 2:205342064-205342086 2:205342117-205342139
Sequence CCACTGTCTGTTGTATCCTCAGC CTGTATGACTAAAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 191} {0: 1, 1: 0, 2: 2, 3: 20, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!