ID: 945023406_945023410

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 945023406 945023410
Species Human (GRCh38) Human (GRCh38)
Location 2:205596705-205596727 2:205596720-205596742
Sequence CCCAAAATGTATGTAATCATGTT ATCATGTTTGTGGCCAAATAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 88, 4: 675} {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!