ID: 945062876_945062878

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 945062876 945062878
Species Human (GRCh38) Human (GRCh38)
Location 2:205924178-205924200 2:205924193-205924215
Sequence CCCAGTTGTGATTCTAGGAGAAG AGGAGAAGAGAGCGAGCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!