ID: 945064768_945064776

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 945064768 945064776
Species Human (GRCh38) Human (GRCh38)
Location 2:205939542-205939564 2:205939577-205939599
Sequence CCGTCCACCACTGCTATTTGCCA CCCGCTGACTTCCATCCCTCCGG
Strand - +
Off-target summary No data {0: 2, 1: 35, 2: 102, 3: 125, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!