ID: 945073405_945073407

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 945073405 945073407
Species Human (GRCh38) Human (GRCh38)
Location 2:206013672-206013694 2:206013689-206013711
Sequence CCGGAATGGTGGAACTTTAAAAT TAAAATGAAAATATGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201} {0: 1, 1: 0, 2: 9, 3: 70, 4: 716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!