ID: 945125727_945125733

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 945125727 945125733
Species Human (GRCh38) Human (GRCh38)
Location 2:206507457-206507479 2:206507477-206507499
Sequence CCTCCCACCTTCACCTTCCACTG CTGTGATTGTAAGTTTTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 268, 4: 4044} {0: 1, 1: 14, 2: 223, 3: 1545, 4: 8161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!