|
Left Crispr |
Right Crispr |
| Crispr ID |
945127076 |
945127081 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:206524494-206524516
|
2:206524532-206524554
|
| Sequence |
CCATTTTCACTCTGCTAATAAAG |
GGTAATTTATAAAGAAAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 179, 2: 2034, 3: 3746, 4: 2600} |
{0: 1415, 1: 1580, 2: 1055, 3: 773, 4: 1268} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|