ID: 945135067_945135085

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 945135067 945135085
Species Human (GRCh38) Human (GRCh38)
Location 2:206618242-206618264 2:206618284-206618306
Sequence CCACTTCTTACCCCCCACCTCCC CCCCATTGGAGACCAGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 214, 4: 1905} {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!