ID: 945135072_945135085

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 945135072 945135085
Species Human (GRCh38) Human (GRCh38)
Location 2:206618256-206618278 2:206618284-206618306
Sequence CCACCTCCCACCCTCTATAATCC CCCCATTGGAGACCAGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 143, 4: 1103} {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!