ID: 945151195_945151196

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 945151195 945151196
Species Human (GRCh38) Human (GRCh38)
Location 2:206793752-206793774 2:206793793-206793815
Sequence CCTCTTTTACTAGCATTCTAGTG TTGTGTCAATGAAAGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113} {0: 1, 1: 1, 2: 6, 3: 64, 4: 956}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!