ID: 945225713_945225720

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 945225713 945225720
Species Human (GRCh38) Human (GRCh38)
Location 2:207529845-207529867 2:207529884-207529906
Sequence CCAGCGCGGGGGCGGGGCCGCTC AGCTCGGCTGTTTCCGTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 322} {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!