ID: 945233522_945233525

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 945233522 945233525
Species Human (GRCh38) Human (GRCh38)
Location 2:207613328-207613350 2:207613347-207613369
Sequence CCAAGTCAGCTCCTTAACAACAG ACAGTTTTAGTTTGGATATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119} {0: 1, 1: 0, 2: 3, 3: 25, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!