ID: 945249604_945249610

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 945249604 945249610
Species Human (GRCh38) Human (GRCh38)
Location 2:207753131-207753153 2:207753179-207753201
Sequence CCAGTATAGTCCAGCACACACCT TATAATAGCTAATAAGGATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107} {0: 1, 1: 1, 2: 2, 3: 19, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!