ID: 945268714_945268717

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 945268714 945268717
Species Human (GRCh38) Human (GRCh38)
Location 2:207917080-207917102 2:207917116-207917138
Sequence CCACACTTTTAGAAGTCATCTAA TTGAAGTAGAATGAGGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 175} {0: 1, 1: 1, 2: 6, 3: 58, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!