ID: 945275522_945275530

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 945275522 945275530
Species Human (GRCh38) Human (GRCh38)
Location 2:207983874-207983896 2:207983910-207983932
Sequence CCACCTTCATCAAGGTTGAGTCC CCACTTCACCCACTGTTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 148} {0: 1, 1: 0, 2: 2, 3: 14, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!