ID: 945335111_945335113

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 945335111 945335113
Species Human (GRCh38) Human (GRCh38)
Location 2:208582932-208582954 2:208582967-208582989
Sequence CCATATCTGTGAAATGTGTTTGT TTGTCTTTGCATGAAGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 669} {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!