ID: 945335213_945335217

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 945335213 945335217
Species Human (GRCh38) Human (GRCh38)
Location 2:208583820-208583842 2:208583842-208583864
Sequence CCCAAGCAGTCTCTGCAAATGTC CCATGAAACCTTGGTGTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176} {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!