ID: 945335536_945335541

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 945335536 945335541
Species Human (GRCh38) Human (GRCh38)
Location 2:208588554-208588576 2:208588574-208588596
Sequence CCGAGAAGAGACCAAAGACTGGG GGGGACAAACCACCAGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 214} {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!