ID: 945345755_945345758

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 945345755 945345758
Species Human (GRCh38) Human (GRCh38)
Location 2:208713479-208713501 2:208713504-208713526
Sequence CCAAACTCAATTCAATTATTCTG GGGAGCCAAAGACTAAAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 279} {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!