ID: 945374227_945374229

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 945374227 945374229
Species Human (GRCh38) Human (GRCh38)
Location 2:209060662-209060684 2:209060690-209060712
Sequence CCTGACTCCTGGTTGGGACAAAG CTTAGAATCCGCAGTCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!