ID: 945404890_945404893

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 945404890 945404893
Species Human (GRCh38) Human (GRCh38)
Location 2:209433421-209433443 2:209433447-209433469
Sequence CCAACAGACACGGTAGAGGATAC GACACTTAAGTCAGAACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48} {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!