|
Left Crispr |
Right Crispr |
| Crispr ID |
945458949 |
945458956 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:210082021-210082043
|
2:210082055-210082077
|
| Sequence |
CCTTCTTGGCTCAAGTGATGCTC |
CTCTGAGTAGCTGGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 11, 2: 674, 3: 10037, 4: 52113} |
{0: 345, 1: 4055, 2: 53542, 3: 175484, 4: 229492} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|